rybalqaisi rybalqaisi

13-10-2020
Mathematics

contestada

what % is 60 of 45%?????????????????

Respuesta :

Аноним Аноним

14-10-2020

Answer: 75%

Explanation:

a = p% of b
45 = p% of 60

so you basically divide 60 by 45.

45 / 60 = .75

.75 is equivalent to 75%

The answer is 75%

Answer Link

Otras preguntas

Which country use tax brackets as part of their tax system? canada australia south africa all of the above?

The term used when an organism is studied in its natural environment is

I just need help with the equation part since when I keep doing I get the wrong answer.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The Hellenistic age was characterized by all of the following EXCEPT

Remembering how to ride a bicycle, even though you have not ridden one for years, is an example of _____ memory.

The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?

PLEASE HELP!!!!!!!! Which of the following is a continuous random variable? A) the number of employees in an office B) the salaries of employees in an off

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

The somatosensory area is to the auditory area what the _____ lobe is to the _____ lobe